ID: 1160454847_1160454855

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1160454847 1160454855
Species Human (GRCh38) Human (GRCh38)
Location 18:78992959-78992981 18:78993008-78993030
Sequence CCGCCCCGGCGCCAGCGCCGCAG CGCATCCACGCCGCCTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 340} {0: 1, 1: 0, 2: 0, 3: 21, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!