ID: 1160577311_1160577322

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1160577311 1160577322
Species Human (GRCh38) Human (GRCh38)
Location 18:79864039-79864061 18:79864068-79864090
Sequence CCGCCGCGAGGAGGAGGCGGCCG GCGCGGGGCCGACGGAGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 189} {0: 1, 1: 0, 2: 2, 3: 18, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!