ID: 1160621049_1160621055

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1160621049 1160621055
Species Human (GRCh38) Human (GRCh38)
Location 18:80170887-80170909 18:80170902-80170924
Sequence CCTTTCCCCAGTTTTGCTGGGGA GCTGGGGAAGGCTGCAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 316} {0: 1, 1: 0, 2: 9, 3: 85, 4: 710}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!