ID: 1160679838_1160679841

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1160679838 1160679841
Species Human (GRCh38) Human (GRCh38)
Location 19:407614-407636 19:407636-407658
Sequence CCTTGGCCTGGCTGTCCTGGGCG GAAACCTTTGAGCAGAGACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 378} {0: 1, 1: 0, 2: 3, 3: 30, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!