ID: 1160684464_1160684467

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1160684464 1160684467
Species Human (GRCh38) Human (GRCh38)
Location 19:427060-427082 19:427075-427097
Sequence CCCAGAGGAACGTGCGCCAGGAC GCCAGGACCAGAGCACAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 60} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!