ID: 1160700012_1160700017

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1160700012 1160700017
Species Human (GRCh38) Human (GRCh38)
Location 19:501705-501727 19:501718-501740
Sequence CCACCTCCCCGGAGTCTCCCGAC GTCTCCCGACACCACCTCCCCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 15, 4: 163} {0: 2, 1: 2, 2: 3, 3: 16, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!