ID: 1160729133_1160729139

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1160729133 1160729139
Species Human (GRCh38) Human (GRCh38)
Location 19:632801-632823 19:632831-632853
Sequence CCTCTCCCGGGCCGCCGTGGGGG CACCCTCCAGCAGCTCCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 182} {0: 1, 1: 0, 2: 3, 3: 43, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!