ID: 1160796851_1160796864

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1160796851 1160796864
Species Human (GRCh38) Human (GRCh38)
Location 19:949558-949580 19:949606-949628
Sequence CCTCGGCCTCCCAAAGTGCTGGG GGCCTTTCCCCTCCCTCCAGTGG
Strand - +
Off-target summary {0: 114360, 1: 259489, 2: 214307, 3: 130302, 4: 170463} {0: 1, 1: 0, 2: 1, 3: 47, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!