ID: 1160860373_1160860380

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1160860373 1160860380
Species Human (GRCh38) Human (GRCh38)
Location 19:1235007-1235029 19:1235047-1235069
Sequence CCCTTGTCCTGCGTCTTGCGGCT CCTCATTGAAGGAGACCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 74} {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!