ID: 1160862203_1160862210

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1160862203 1160862210
Species Human (GRCh38) Human (GRCh38)
Location 19:1242126-1242148 19:1242152-1242174
Sequence CCCTCGGCCCTGCCTCTGCTGCC GCCCTGCGCTGCCCTCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 589} {0: 1, 1: 0, 2: 2, 3: 17, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!