ID: 1160908071_1160908084

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1160908071 1160908084
Species Human (GRCh38) Human (GRCh38)
Location 19:1461022-1461044 19:1461072-1461094
Sequence CCTCACCCCACCCAGGTGGTGTC GGCCGACATCAACAGCAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 64, 4: 362} {0: 1, 1: 0, 2: 0, 3: 11, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!