ID: 1160939132_1160939141

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1160939132 1160939141
Species Human (GRCh38) Human (GRCh38)
Location 19:1611971-1611993 19:1611993-1612015
Sequence CCTGTATTTCCGGCTCTCACCTC CCTTCCTTGAGAAGGCTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 122} {0: 1, 1: 0, 2: 1, 3: 24, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!