ID: 1160942009_1160942014

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1160942009 1160942014
Species Human (GRCh38) Human (GRCh38)
Location 19:1624659-1624681 19:1624691-1624713
Sequence CCGGAAACCAGCACTCAGGCGCC ACTCACGGACGTGCGCACAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!