|
Left Crispr |
Right Crispr |
| Crispr ID |
1160995394 |
1160995408 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:1879903-1879925
|
19:1879953-1879975
|
| Sequence |
CCCCAGGGTCGCCCTCACCTGGT |
GTCGGCATAGAGGTTCCTCTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 2, 2: 2, 3: 22, 4: 159} |
{0: 5, 1: 1, 2: 6, 3: 9, 4: 55} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|