ID: 1161027572_1161027577

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1161027572 1161027577
Species Human (GRCh38) Human (GRCh38)
Location 19:2043563-2043585 19:2043595-2043617
Sequence CCTGGCTGCTTCTCAATGATCTG AAAGGACACAGCACCTGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 633} {0: 1, 1: 0, 2: 4, 3: 27, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!