ID: 1161038825_1161038836

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1161038825 1161038836
Species Human (GRCh38) Human (GRCh38)
Location 19:2099357-2099379 19:2099401-2099423
Sequence CCTGCCCCAGGGCAACGTGGGGG CCTGCCTGTCACTCTGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 224} {0: 1, 1: 0, 2: 2, 3: 36, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!