ID: 1161039149_1161039165

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1161039149 1161039165
Species Human (GRCh38) Human (GRCh38)
Location 19:2100786-2100808 19:2100823-2100845
Sequence CCTGCTCCCCTGCACGGCCTTGG GACCGAGGCCACCACGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 46, 4: 355} {0: 1, 1: 0, 2: 0, 3: 19, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!