ID: 1161041116_1161041122

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1161041116 1161041122
Species Human (GRCh38) Human (GRCh38)
Location 19:2111228-2111250 19:2111251-2111273
Sequence CCCATGCCAAAGAGTGTGGGCTG GCCCACCCTGCCCCTGGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149} {0: 1, 1: 0, 2: 6, 3: 53, 4: 474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!