ID: 1161072512_1161072536

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1161072512 1161072536
Species Human (GRCh38) Human (GRCh38)
Location 19:2269912-2269934 19:2269960-2269982
Sequence CCCCCGGCCTTAGCAGTGCTCTC GGTGCGGAGTTGGATTTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!