ID: 1161210341_1161210347

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1161210341 1161210347
Species Human (GRCh38) Human (GRCh38)
Location 19:3062375-3062397 19:3062390-3062412
Sequence CCCCGGCGCGCCCCGGGCCCCGC GGCCCCGCTTCCTGCGCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 154, 4: 976} {0: 1, 1: 1, 2: 0, 3: 28, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!