ID: 1161323377_1161323390

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1161323377 1161323390
Species Human (GRCh38) Human (GRCh38)
Location 19:3651614-3651636 19:3651659-3651681
Sequence CCAAGGCCCGGAACCCTGCACTC CTGGCTTCGCTCTGAGGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 194} {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!