ID: 1161366092_1161366099

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1161366092 1161366099
Species Human (GRCh38) Human (GRCh38)
Location 19:3880679-3880701 19:3880701-3880723
Sequence CCGAGCCTCTGCCAGCCCTGAGC CTGGGAAGAAGCAGCTACCTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 75, 4: 621} {0: 1, 1: 0, 2: 2, 3: 30, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!