ID: 1161483751_1161483763

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1161483751 1161483763
Species Human (GRCh38) Human (GRCh38)
Location 19:4523875-4523897 19:4523915-4523937
Sequence CCCGGCCCTCGGCCAGCGCGGCC GCAGCGGGCATCAGCGAAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 409} {0: 1, 1: 0, 2: 0, 3: 13, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!