ID: 1161601848_1161601864

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1161601848 1161601864
Species Human (GRCh38) Human (GRCh38)
Location 19:5188963-5188985 19:5189015-5189037
Sequence CCCACCACCCCATCTCTTCCCAC GAGACACTCAGCCTGGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 820} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!