ID: 1161613728_1161613735

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1161613728 1161613735
Species Human (GRCh38) Human (GRCh38)
Location 19:5257989-5258011 19:5258016-5258038
Sequence CCTTTGACCTGGACGCGGCGTTC CCTCGCACGTAGAGGTTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28} {0: 1, 1: 0, 2: 0, 3: 4, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!