ID: 1161665362_1161665366

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1161665362 1161665366
Species Human (GRCh38) Human (GRCh38)
Location 19:5572800-5572822 19:5572816-5572838
Sequence CCATCATAATTGCTGGTGTCCAA TGTCCAAGAAGGTCAAAGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!