ID: 1161683759_1161683763

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1161683759 1161683763
Species Human (GRCh38) Human (GRCh38)
Location 19:5693239-5693261 19:5693255-5693277
Sequence CCTGTCCCGTGGTGGTGTGGGCC GTGGGCCCTGCCAGTGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137} {0: 1, 1: 0, 2: 3, 3: 28, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!