ID: 1161683759_1161683767

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1161683759 1161683767
Species Human (GRCh38) Human (GRCh38)
Location 19:5693239-5693261 19:5693260-5693282
Sequence CCTGTCCCGTGGTGGTGTGGGCC CCCTGCCAGTGCTGTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137} {0: 1, 1: 0, 2: 4, 3: 43, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!