ID: 1161690528_1161690542

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1161690528 1161690542
Species Human (GRCh38) Human (GRCh38)
Location 19:5730703-5730725 19:5730754-5730776
Sequence CCAGGAGTTCAATACCACCAGCC TGTAATCCCAGCACTTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 19, 3: 66, 4: 333} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!