ID: 1161752924_1161752935

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1161752924 1161752935
Species Human (GRCh38) Human (GRCh38)
Location 19:6110542-6110564 19:6110566-6110588
Sequence CCGCCGCCAGCCAGCCTCGCGCA CCCGCCCGCCCGACGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 245} {0: 1, 1: 0, 2: 3, 3: 16, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!