ID: 1161756413_1161756423

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1161756413 1161756423
Species Human (GRCh38) Human (GRCh38)
Location 19:6137396-6137418 19:6137447-6137469
Sequence CCAAGGAAGGACTGCACCTGGTG TGGCTGCAGCAGAGTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!