ID: 1161841771_1161841782

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1161841771 1161841782
Species Human (GRCh38) Human (GRCh38)
Location 19:6686043-6686065 19:6686091-6686113
Sequence CCTCAGTGTCTTCTCTAGGAGGC ATGCATGTGCCTAGGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 225} {0: 1, 1: 0, 2: 0, 3: 13, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!