ID: 1161908401_1161908408

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1161908401 1161908408
Species Human (GRCh38) Human (GRCh38)
Location 19:7174708-7174730 19:7174750-7174772
Sequence CCCAGGCATGGGGTGCACAGCAA GAGAGAGAAAGAGAAAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 161} {0: 2, 1: 37, 2: 429, 3: 2662, 4: 11733}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!