ID: 1161908402_1161908413

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1161908402 1161908413
Species Human (GRCh38) Human (GRCh38)
Location 19:7174709-7174731 19:7174762-7174784
Sequence CCAGGCATGGGGTGCACAGCAAG GAAAGGGGAGGGGGGTGTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 207} {0: 1, 1: 0, 2: 6, 3: 72, 4: 727}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!