ID: 1161925701_1161925711

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1161925701 1161925711
Species Human (GRCh38) Human (GRCh38)
Location 19:7297501-7297523 19:7297552-7297574
Sequence CCCAGGCTGGAGAGCAGTGGCCC CTGGGTTCAAGCGATCTTCCTGG
Strand - +
Off-target summary {0: 24, 1: 3021, 2: 113927, 3: 230094, 4: 217662} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!