ID: 1161955048_1161955060

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1161955048 1161955060
Species Human (GRCh38) Human (GRCh38)
Location 19:7489045-7489067 19:7489083-7489105
Sequence CCGCGCCAGGGGGCGGGGCCAGG CGCCCCAAAGGCTTGCGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 475} {0: 1, 1: 0, 2: 0, 3: 4, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!