ID: 1161959490_1161959505

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1161959490 1161959505
Species Human (GRCh38) Human (GRCh38)
Location 19:7516071-7516093 19:7516109-7516131
Sequence CCCAGCAGCTCCCGCTGCGGCCC CGCTCCCCGGGAGCGCCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 343} {0: 1, 1: 0, 2: 1, 3: 16, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!