ID: 1162004044_1162004053

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1162004044 1162004053
Species Human (GRCh38) Human (GRCh38)
Location 19:7765831-7765853 19:7765882-7765904
Sequence CCAGGAGCTGACCCGGCTGAAGG CAAGCTGCAGGAGATCTACCAGG
Strand - +
Off-target summary {0: 6, 1: 6, 2: 1, 3: 18, 4: 190} {0: 7, 1: 2, 2: 4, 3: 22, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!