ID: 1162039806_1162039816

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1162039806 1162039816
Species Human (GRCh38) Human (GRCh38)
Location 19:7963887-7963909 19:7963932-7963954
Sequence CCATGGCCGCTGGGCCCCATCCC TCACGGTTGAGACACCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 324} {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!