ID: 1162060908_1162060923

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1162060908 1162060923
Species Human (GRCh38) Human (GRCh38)
Location 19:8094632-8094654 19:8094684-8094706
Sequence CCAACACCTGCAATCACTGTGTG CAGTGGCAATTCTGGCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 160} {0: 1, 1: 0, 2: 1, 3: 35, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!