ID: 1162100248_1162100261

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1162100248 1162100261
Species Human (GRCh38) Human (GRCh38)
Location 19:8334800-8334822 19:8334840-8334862
Sequence CCTCGGTCACCCACGCGTCCGCC AGCCTCCACGCCGGCCTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72} {0: 1, 1: 0, 2: 9, 3: 62, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!