ID: 1162125619_1162125625

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1162125619 1162125625
Species Human (GRCh38) Human (GRCh38)
Location 19:8498279-8498301 19:8498299-8498321
Sequence CCTCCGTAGATCTGTGGGGTAGA AGAGAGTAGGGCAGGGAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42} {0: 1, 1: 0, 2: 5, 3: 83, 4: 902}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!