ID: 1162219120_1162219124

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1162219120 1162219124
Species Human (GRCh38) Human (GRCh38)
Location 19:9161108-9161130 19:9161146-9161168
Sequence CCCGGCGGAGGCACATGAGCGTT CGAGTTGAGTGTAGGCAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 34} {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!