ID: 1162219120_1162219126

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1162219120 1162219126
Species Human (GRCh38) Human (GRCh38)
Location 19:9161108-9161130 19:9161159-9161181
Sequence CCCGGCGGAGGCACATGAGCGTT GGCAGTGTGGCAAGGCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 34} {0: 1, 1: 0, 2: 6, 3: 31, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!