ID: 1162341653_1162341666

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1162341653 1162341666
Species Human (GRCh38) Human (GRCh38)
Location 19:10094890-10094912 19:10094921-10094943
Sequence CCACAAGACGGACCGGAACCACA TGGGGGTGGCGGCAGGACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42} {0: 1, 1: 1, 2: 10, 3: 55, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!