ID: 1162349129_1162349133

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1162349129 1162349133
Species Human (GRCh38) Human (GRCh38)
Location 19:10138225-10138247 19:10138246-10138268
Sequence CCGCTCTGCACATGCTATCTACT CTAGGGAAGCAGATGATGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 176} {0: 1, 1: 0, 2: 10, 3: 32, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!