ID: 1162393956_1162393962

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1162393956 1162393962
Species Human (GRCh38) Human (GRCh38)
Location 19:10405311-10405333 19:10405327-10405349
Sequence CCGGAGCCTCAGCTTCCAGAACT CAGAACTGGGGATAGAGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 101, 4: 879} {0: 1, 1: 0, 2: 1, 3: 19, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!