ID: 1162418995_1162418999

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1162418995 1162418999
Species Human (GRCh38) Human (GRCh38)
Location 19:10555185-10555207 19:10555198-10555220
Sequence CCTGCAGACAGATGCCCCTGTGT GCCCCTGTGTTGGGTGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 175} {0: 1, 1: 0, 2: 1, 3: 33, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!