ID: 1162421024_1162421028

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1162421024 1162421028
Species Human (GRCh38) Human (GRCh38)
Location 19:10566125-10566147 19:10566144-10566166
Sequence CCGGGATCCCTTTCGCCTCATCA ATCACCGCAGTCACCGCCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102} {0: 1, 1: 0, 2: 1, 3: 8, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!