ID: 1162422351_1162422362

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1162422351 1162422362
Species Human (GRCh38) Human (GRCh38)
Location 19:10573036-10573058 19:10573089-10573111
Sequence CCGTGTTCAAGCCCCCATCTCTT CTGCAGAGAAAGAATGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 361} {0: 1, 1: 0, 2: 2, 3: 67, 4: 707}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!